 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circATXN10 | |||
| Gene | ATXN10 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Cardiovascular Disease | ICD-10 | Cardiovascular disease, unspecified (I51.6) |
| DBLink | Link to database | PMID | 28676412 |
| Experimental Method | |||
| Sample Type | Tissues and hiPSC Cell lines | Comparison | hiPSC cells with adrenergic stimulation and 8 failing myocardium vs non failing controls |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GGATGGTATCCCGTTGATCCTGG ReverseCCTAAAATGAAGGTGCAGGCTCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Siede, D, Rapti, K, Gorska, AA, Katus, HA, Altmuller, J, Boeckel, JN, Meder, B, Maack, C, Volkers, M, Muller, OJ, Backs, J, Dieterich, C (2017). Identification of circular RNAs with host gene-independent expression in human model systems for cardiac differentiation and disease. J. Mol. Cell. Cardiol., 109:48-56. | |||